gfra 1 Search Results


86
Proteintech rabbit lifesspan ls c482396 gfra1
Rabbit Lifesspan Ls C482396 Gfra1, supplied by Proteintech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pm41562564-73-9-20?v=Proteintech
Average 86 stars, based on 1 article reviews
rabbit lifesspan ls c482396 gfra1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
OriGene gfra1 rg219943 expression vectors
Gfra1 Rg219943 Expression Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc06792140-41-5-12?v=OriGene
Average 90 stars, based on 1 article reviews
gfra1 rg219943 expression vectors - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
OriGene pcmv6 kan neo gfra1
Pcmv6 Kan Neo Gfra1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc07700293-124-0-4?v=OriGene
Average 90 stars, based on 1 article reviews
pcmv6 kan neo gfra1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp gfra1 mm00439086 m1
PCR primers
Gene Exp Gfra1 Mm00439086 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc04763785-175-54--1?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp gfra1 mm00439086 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

97
Thermo Fisher gene exp gfra1 hs00237133 m1
PCR primers
Gene Exp Gfra1 Hs00237133 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc03686594-87-31-26?v=Thermo+Fisher
Average 97 stars, based on 1 article reviews
gene exp gfra1 hs00237133 m1 - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp gfra1 rn01444617 m1
PCR primers
Gene Exp Gfra1 Rn01444617 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc05581815__table_1-0-111--1?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp gfra1 rn01444617 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

91
Boster Bio ttgtcatctacccgacattgg gfra1
PCR primers
Ttgtcatctacccgacattgg Gfra1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc06111072__mmc2-220-64-130?v=Boster+Bio
Average 91 stars, based on 1 article reviews
ttgtcatctacccgacattgg gfra1 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

90
Sino Biological human gfra1 protein
PCR primers
Human Gfra1 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pm29796165-208-23-26?v=Sino+Biological
Average 90 stars, based on 1 article reviews
human gfra1 protein - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Boster Bio anti gfra1
Primer of PCR
Anti Gfra1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc10905883-82-32-34?v=Boster+Bio
Average 93 stars, based on 1 article reviews
anti gfra1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Sino Biological gfrα1
P4-10 CAR T cells specifically respond to GFRα4 protein in vitro (A) Schematic of CAR construct inserted downstream of an EF1a-derived promoter within a 3 rd -generation lentiviral vector plasmid. (B) Primary human T cells were activated using anti-CD3/anti-CD28-coated beads followed by transduction with lentiviral vectors encoding the indicated CAR genes or were left non-transduced (NTD). Seven days later, T cells were stained with biotinylated F(ab′) 2 -specifc goat anti-mouse or donkey anti-rabbit followed by streptavidin-AF647 and analysis by flow cytometry. (C) NFAT-GFP reporter Jurkat cells expressing no CAR (NTD), 19bbz, or the P4-10bbz CAR were cultured in wells that had been coated overnight with <t>GFRα1,</t> GFRα2, GFRα3, GFRα4, and OKT3 proteins. Following overnight culture, cells were analyzed by flow cytometry for GFP expression. A representative of 3 independent experiments is shown. (D and E) NFAT-GFP reporter Jurkat cells (D) or primary human T cells (E) expressing no CAR (NTD), or the P4-10bbz CAR were cultured in wells that had been coated overnight with OKT3 or GFRα4 (bound) or in media with soluble GFRα4 (soluble). Following overnight culture, cells were analyzed by flow cytometry for GFP expression (*p < 0.001 compared to media control, ANOVA, Dunnett’s multiple comparisons test). Representatives of 2 independent experiments each are shown. Error bars indicate 1 standard deviation of the mean.
Gfrα1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc07879023-175-2-15?v=Sino+Biological
Average 94 stars, based on 1 article reviews
gfrα1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Thermo Fisher copy number variation gfra1 mm00495590 cn
P4-10 CAR T cells specifically respond to GFRα4 protein in vitro (A) Schematic of CAR construct inserted downstream of an EF1a-derived promoter within a 3 rd -generation lentiviral vector plasmid. (B) Primary human T cells were activated using anti-CD3/anti-CD28-coated beads followed by transduction with lentiviral vectors encoding the indicated CAR genes or were left non-transduced (NTD). Seven days later, T cells were stained with biotinylated F(ab′) 2 -specifc goat anti-mouse or donkey anti-rabbit followed by streptavidin-AF647 and analysis by flow cytometry. (C) NFAT-GFP reporter Jurkat cells expressing no CAR (NTD), 19bbz, or the P4-10bbz CAR were cultured in wells that had been coated overnight with <t>GFRα1,</t> GFRα2, GFRα3, GFRα4, and OKT3 proteins. Following overnight culture, cells were analyzed by flow cytometry for GFP expression. A representative of 3 independent experiments is shown. (D and E) NFAT-GFP reporter Jurkat cells (D) or primary human T cells (E) expressing no CAR (NTD), or the P4-10bbz CAR were cultured in wells that had been coated overnight with OKT3 or GFRα4 (bound) or in media with soluble GFRα4 (soluble). Following overnight culture, cells were analyzed by flow cytometry for GFP expression (*p < 0.001 compared to media control, ANOVA, Dunnett’s multiple comparisons test). Representatives of 2 independent experiments each are shown. Error bars indicate 1 standard deviation of the mean.
Copy Number Variation Gfra1 Mm00495590 Cn, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc11585002-106-13-23?v=Thermo+Fisher
Average 93 stars, based on 1 article reviews
copy number variation gfra1 mm00495590 cn - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp gfra1 mm00833897 m1
P4-10 CAR T cells specifically respond to GFRα4 protein in vitro (A) Schematic of CAR construct inserted downstream of an EF1a-derived promoter within a 3 rd -generation lentiviral vector plasmid. (B) Primary human T cells were activated using anti-CD3/anti-CD28-coated beads followed by transduction with lentiviral vectors encoding the indicated CAR genes or were left non-transduced (NTD). Seven days later, T cells were stained with biotinylated F(ab′) 2 -specifc goat anti-mouse or donkey anti-rabbit followed by streptavidin-AF647 and analysis by flow cytometry. (C) NFAT-GFP reporter Jurkat cells expressing no CAR (NTD), 19bbz, or the P4-10bbz CAR were cultured in wells that had been coated overnight with <t>GFRα1,</t> GFRα2, GFRα3, GFRα4, and OKT3 proteins. Following overnight culture, cells were analyzed by flow cytometry for GFP expression. A representative of 3 independent experiments is shown. (D and E) NFAT-GFP reporter Jurkat cells (D) or primary human T cells (E) expressing no CAR (NTD), or the P4-10bbz CAR were cultured in wells that had been coated overnight with OKT3 or GFRα4 (bound) or in media with soluble GFRα4 (soluble). Following overnight culture, cells were analyzed by flow cytometry for GFP expression (*p < 0.001 compared to media control, ANOVA, Dunnett’s multiple comparisons test). Representatives of 2 independent experiments each are shown. Error bars indicate 1 standard deviation of the mean.
Gene Exp Gfra1 Mm00833897 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfra+1/pmc03935946__pone__0089881__s006-0-47--1?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp gfra1 mm00833897 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


PCR primers

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Targeting the Gdnf Gene in peritubular myoid cells disrupts undifferentiated spermatogonial cell development

doi: 10.1073/pnas.1517994113

Figure Lengend Snippet: PCR primers

Article Snippet: Expression at 4 wk for ( D ) Fgf2 , ( E ) Lif , ( C ) Csf1 , and ( F ) Kit . table ft1 table-wrap mode="anchored" t5 Table S3. caption a7 Gene name Taqman primer gene ID Fgf2 Mm00433287_m1 Zbtb16 Mm01176868_m1 Bcl6b Mm00455912_g1 Lif Mm00434762_g1 Csf1 Mm00432686_m1 Nanos2 Mm02525720_s1 Gfra1 Mm00439086_m1 Kit Mm00445212_m1 Nanos3 Mm00808138_m1 Sox9 Mm00448840_m1 Open in a separate window PCR primers We also evaluated the expression of genes in testes of 1-wk-old WT, Het, and cKO mice for markers of SSCs and undifferentiated spermatogonia ( and ), including Bcl6b ( 16 ), Zbtb16 ( 15 , 41 ), and Nanos2 ( 42 ), and for markers of differentiating spermatogonia, including Ngn3 ( 18 , 43 ), Kit ( 21 ), Nanos3 ( 44 ), Spo11 ( 45 ), and Dnmt3l ( 46 ).

Techniques:

Steady-state levels of molecular markers for undifferentiated and differentiated spermatogonia in testes from 4-wk-old WT, Het, and cKO mice. Expression levels of markers for undifferentiated spermatogonia genes (A) Bcl6b, (B) Gfra1, (C) Zbtb16, and (D) Ret. Expression levels of markers for differentiated spermatogonia: (E) Spo11, (F) Nanos3, (G) Kit, and (H) Dnmt3l. *P < 0.05.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Targeting the Gdnf Gene in peritubular myoid cells disrupts undifferentiated spermatogonial cell development

doi: 10.1073/pnas.1517994113

Figure Lengend Snippet: Steady-state levels of molecular markers for undifferentiated and differentiated spermatogonia in testes from 4-wk-old WT, Het, and cKO mice. Expression levels of markers for undifferentiated spermatogonia genes (A) Bcl6b, (B) Gfra1, (C) Zbtb16, and (D) Ret. Expression levels of markers for differentiated spermatogonia: (E) Spo11, (F) Nanos3, (G) Kit, and (H) Dnmt3l. *P < 0.05.

Article Snippet: Expression at 4 wk for ( D ) Fgf2 , ( E ) Lif , ( C ) Csf1 , and ( F ) Kit . table ft1 table-wrap mode="anchored" t5 Table S3. caption a7 Gene name Taqman primer gene ID Fgf2 Mm00433287_m1 Zbtb16 Mm01176868_m1 Bcl6b Mm00455912_g1 Lif Mm00434762_g1 Csf1 Mm00432686_m1 Nanos2 Mm02525720_s1 Gfra1 Mm00439086_m1 Kit Mm00445212_m1 Nanos3 Mm00808138_m1 Sox9 Mm00448840_m1 Open in a separate window PCR primers We also evaluated the expression of genes in testes of 1-wk-old WT, Het, and cKO mice for markers of SSCs and undifferentiated spermatogonia ( and ), including Bcl6b ( 16 ), Zbtb16 ( 15 , 41 ), and Nanos2 ( 42 ), and for markers of differentiating spermatogonia, including Ngn3 ( 18 , 43 ), Kit ( 21 ), Nanos3 ( 44 ), Spo11 ( 45 ), and Dnmt3l ( 46 ).

Techniques: Expressing

Primer of PCR

Journal: BMC Genomics

Article Title: JMJD3 regulate H3K27me3 modification via interacting directly with TET1 to affect spermatogonia self-renewal and proliferation

doi: 10.1186/s12864-024-10120-9

Figure Lengend Snippet: Primer of PCR

Article Snippet: Proteins were analyzed with anti-β-actin (1:10000, 66009-1-Ig, Proteintech), anti-EZH2 (1:1000, 21800-1-AP, Proteintech), anti-JMJD3 (1:1000, A01309, BOSTER), anti-H3 (1;1000, A12477-2, BOSTER), anti-H3K27me3 (1:1000, #9733, CST), anti-PCNA (1:1000, BS6438, Bioworld), anti-DAZL (1:1000, A02069-2, BOSTER), anti-GFRA1(1:1000, PB0199, BOSTER) anti-AKT (1:1000, T55561, Abmart), anti-P-AKT (1;1000, T40067, Abmart).

Techniques:

Effects of EZH2 interference or overexpression and JMJD3 interference or overexpression on self-renewal, proliferation and differentiation of spermatogonia. ( A ) The mRNA levels of PCNA, Cyclin-A, GFRA1, PLZF and C-KIT related to spermatogonia self-renewal and proliferation were changed after EZH2 and JMJD3 knockdown. ( B ) The expression of PCNA, cyclin-A, GFRA1, PLZF, C-KIT, DAZL and VASA was detected by qRT-PCR after EZH2 and JMJD3 overexpression. ( C ) The protein expression changes as well as statistical analysis of PCNA, DAZL and GFRA1 after EZH2 and JMJD3 overexpression. The membrane is lysed prior to hybridization with the antibody and the image has been cropped for a more aesthetically pleasing display. The full- length blots can be obtained from Additional file 2: Fig . ( D ) The cell cycle of EZH2 and JMJD3 overexpression cells was detected by flow cytometry. ( E ) Protein interaction network of EZH2, JMJD3 and spermatogonia self-renewal, proliferation and differentiation-related genes

Journal: BMC Genomics

Article Title: JMJD3 regulate H3K27me3 modification via interacting directly with TET1 to affect spermatogonia self-renewal and proliferation

doi: 10.1186/s12864-024-10120-9

Figure Lengend Snippet: Effects of EZH2 interference or overexpression and JMJD3 interference or overexpression on self-renewal, proliferation and differentiation of spermatogonia. ( A ) The mRNA levels of PCNA, Cyclin-A, GFRA1, PLZF and C-KIT related to spermatogonia self-renewal and proliferation were changed after EZH2 and JMJD3 knockdown. ( B ) The expression of PCNA, cyclin-A, GFRA1, PLZF, C-KIT, DAZL and VASA was detected by qRT-PCR after EZH2 and JMJD3 overexpression. ( C ) The protein expression changes as well as statistical analysis of PCNA, DAZL and GFRA1 after EZH2 and JMJD3 overexpression. The membrane is lysed prior to hybridization with the antibody and the image has been cropped for a more aesthetically pleasing display. The full- length blots can be obtained from Additional file 2: Fig . ( D ) The cell cycle of EZH2 and JMJD3 overexpression cells was detected by flow cytometry. ( E ) Protein interaction network of EZH2, JMJD3 and spermatogonia self-renewal, proliferation and differentiation-related genes

Article Snippet: Proteins were analyzed with anti-β-actin (1:10000, 66009-1-Ig, Proteintech), anti-EZH2 (1:1000, 21800-1-AP, Proteintech), anti-JMJD3 (1:1000, A01309, BOSTER), anti-H3 (1;1000, A12477-2, BOSTER), anti-H3K27me3 (1:1000, #9733, CST), anti-PCNA (1:1000, BS6438, Bioworld), anti-DAZL (1:1000, A02069-2, BOSTER), anti-GFRA1(1:1000, PB0199, BOSTER) anti-AKT (1:1000, T55561, Abmart), anti-P-AKT (1;1000, T40067, Abmart).

Techniques: Over Expression, Knockdown, Expressing, Quantitative RT-PCR, Membrane, Hybridization, Flow Cytometry

P4-10 CAR T cells specifically respond to GFRα4 protein in vitro (A) Schematic of CAR construct inserted downstream of an EF1a-derived promoter within a 3 rd -generation lentiviral vector plasmid. (B) Primary human T cells were activated using anti-CD3/anti-CD28-coated beads followed by transduction with lentiviral vectors encoding the indicated CAR genes or were left non-transduced (NTD). Seven days later, T cells were stained with biotinylated F(ab′) 2 -specifc goat anti-mouse or donkey anti-rabbit followed by streptavidin-AF647 and analysis by flow cytometry. (C) NFAT-GFP reporter Jurkat cells expressing no CAR (NTD), 19bbz, or the P4-10bbz CAR were cultured in wells that had been coated overnight with GFRα1, GFRα2, GFRα3, GFRα4, and OKT3 proteins. Following overnight culture, cells were analyzed by flow cytometry for GFP expression. A representative of 3 independent experiments is shown. (D and E) NFAT-GFP reporter Jurkat cells (D) or primary human T cells (E) expressing no CAR (NTD), or the P4-10bbz CAR were cultured in wells that had been coated overnight with OKT3 or GFRα4 (bound) or in media with soluble GFRα4 (soluble). Following overnight culture, cells were analyzed by flow cytometry for GFP expression (*p < 0.001 compared to media control, ANOVA, Dunnett’s multiple comparisons test). Representatives of 2 independent experiments each are shown. Error bars indicate 1 standard deviation of the mean.

Journal: Molecular Therapy Oncolytics

Article Title: Adoptive T cell immunotherapy for medullary thyroid carcinoma targeting GDNF family receptor alpha 4

doi: 10.1016/j.omto.2021.01.012

Figure Lengend Snippet: P4-10 CAR T cells specifically respond to GFRα4 protein in vitro (A) Schematic of CAR construct inserted downstream of an EF1a-derived promoter within a 3 rd -generation lentiviral vector plasmid. (B) Primary human T cells were activated using anti-CD3/anti-CD28-coated beads followed by transduction with lentiviral vectors encoding the indicated CAR genes or were left non-transduced (NTD). Seven days later, T cells were stained with biotinylated F(ab′) 2 -specifc goat anti-mouse or donkey anti-rabbit followed by streptavidin-AF647 and analysis by flow cytometry. (C) NFAT-GFP reporter Jurkat cells expressing no CAR (NTD), 19bbz, or the P4-10bbz CAR were cultured in wells that had been coated overnight with GFRα1, GFRα2, GFRα3, GFRα4, and OKT3 proteins. Following overnight culture, cells were analyzed by flow cytometry for GFP expression. A representative of 3 independent experiments is shown. (D and E) NFAT-GFP reporter Jurkat cells (D) or primary human T cells (E) expressing no CAR (NTD), or the P4-10bbz CAR were cultured in wells that had been coated overnight with OKT3 or GFRα4 (bound) or in media with soluble GFRα4 (soluble). Following overnight culture, cells were analyzed by flow cytometry for GFP expression (*p < 0.001 compared to media control, ANOVA, Dunnett’s multiple comparisons test). Representatives of 2 independent experiments each are shown. Error bars indicate 1 standard deviation of the mean.

Article Snippet: Expression of GFRα1, GFRα2, and GFRα3 was assessed using polyclonal rabbit anti-GFRα1, anti-GFRα2, and anti-GFRα3 (Sino Biologicals, Wayne, PA, USA) followed by AF647-conjugated goat anti-rabbit antibody (Thermo Fisher Scientific).

Techniques: In Vitro, Construct, Derivative Assay, Plasmid Preparation, Transduction, Staining, Flow Cytometry, Expressing, Cell Culture, Standard Deviation